Stem-loop sequence api-mir-307

AccessionMI0013930 (change log)
Previous IDsapi-mir-307-1
DescriptionAcyrthosiphon pisum miR-307 stem-loop
Gene family MIPF0000293; mir-67
Literature search

1 open access papers mention api-mir-307
(2 sentences)

Stem-loop
   --a         uuu  a    a  --u  a 
5'    cucacucaa   gg ugug ug   uc a
      |||||||||   || |||| ||   || a
3'    gagugaguu   cc acac ac   gg u
   agc         ccu  a    c  cgc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350510.1: 73409-73469 [-]
intergenic
Database links

Mature sequence api-miR-307

Accession MIMAT0014729
Sequence

39 - 

ccacaaccuccuugagugagcga

 - 61

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).