Stem-loop sequence api-mir-34

AccessionMI0013935 (change log)
DescriptionAcyrthosiphon pisum miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

2 open access papers mention api-mir-34
(5 sentences)

Stem-loop
   --   c      a    c        uac   uuu 
5'   ugg agugug uuag ugguugug   aua   g
     ||| |||||| |||| ||||||||   |||    
3'   acc uuacac aauc accggcac   uau   a
   uc   -      g    -        uca   uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349754.1: 863528-863595 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-34
api-mir-277GL349754.1: 855885-855963 [+]
api-mir-34GL349754.1: 863528-863595 [+]
Database links

Mature sequence api-miR-34

Accession MIMAT0014733
Sequence

1 - 

uggcagugugauuagcugguu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).