Stem-loop sequence api-mir-965

AccessionMI0013948 (change log)
DescriptionAcyrthosiphon pisum miR-965 stem-loop
Gene family MIPF0000708; mir-965
Literature search

1 open access papers mention api-mir-965
(1 sentences)

Stem-loop
   --ga            a  g     uucaua 
5'     ggaaaaguuaua cg uuaug      a
       |||||||||||| || |||||       
3'     ccuuuucgauau gc aaugc      u
   uucc            -  g     ugacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL351142.1: 47370-47430 [-]
intergenic
Database links

Mature sequence api-miR-965

Accession MIMAT0014744
Sequence

40 - 

uaagcguauagcuuuuccccuu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).