Dead miRNA entry

miRNA accession:
MI0013950
miRNA ID:
api-mir-971-2
Forward to:
MI0013949
Comment:
Two previously annotated mir-971 entries map to the same locus in the AphidBase2 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence api-mir-971-2

AccessionMI0013950 (change log)
DescriptionAcyrthosiphon pisum miR-971-2 stem-loop
Stem-loop
   --    u    u             cucag 
5'   cacu uaag uugagcaccaagc     g
     |||| |||| |||||||||||||      
3'   guga auuc aacuugugguuug     c
   ga    c    c             uuauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence api-miR-971

Accession MIMAT0014745
Sequence

38 - 

uuugguguucaaccuuacaguga

 - 60

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).