Stem-loop sequence api-mir-996

AccessionMI0013951 (change log)
Previous IDsapi-mir-996-1
DescriptionAcyrthosiphon pisum miR-996 stem-loop
Gene family MIPF0000449; mir-996
Stem-loop
   --          u       g    -   au 
5'   acggguguag cuuuagu cacg uua  a
     |||||||||| ||||||| |||| |||  u
3'   ugcucacauu gagauca gugc gau  u
   ac          -       -    u   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350191.1: 494537-494596 [-]
intergenic
Database links

Mature sequence api-miR-996

Accession MIMAT0014746
Sequence

40 - 

ugacuagaguuacacucguca

 - 60

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).