Stem-loop sequence api-mir-3017a

AccessionMI0013959 (change log)
DescriptionAcyrthosiphon pisum miR-3017a stem-loop
Stem-loop
   --         a        u    u g 
5'   ccguguucu ugauagac cggc g c
     ||||||||| |||||||| |||| |  
3'   ggcacaaga gcugucug gccg c g
   ac         c        -    u c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL351009.1: 15608-15662 [+]
intergenic
Database links

Mature sequence api-miR-3017a

Accession MIMAT0014752
Sequence

34 - 

cggucugucgcagaacacggca

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).