Stem-loop sequence api-mir-3018

AccessionMI0013961 (change log)
DescriptionAcyrthosiphon pisum miR-3018 stem-loop
Stem-loop
   --               c       aauu 
5'   ccuucgauuuucuau cuuuuau    u
     ||||||||||||||| |||||||     
3'   ggaagcuaaaagaua gaaaaua    u
   gu               a       aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349796.1: 827920-827977 [+]
intergenic
Database links

Mature sequence api-miR-3018

Accession MIMAT0014754
Sequence

37 - 

aaagaauagaaaaucgaaggug

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).