Stem-loop sequence api-mir-3020

AccessionMI0013963 (change log)
DescriptionAcyrthosiphon pisum miR-3020 stem-loop
Stem-loop
   --  aa   u       c      a   a  c 
5'   gu  gaa aaugauc auuaga ggu ua a
     ||  ||| ||||||| |||||| ||| ||  
3'   ca  cuu uuacuag uaaucu cua au a
   ga  gc   u       a      a   a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350475.1: 216414-216477 [-]
intergenic
Database links

Mature sequence api-miR-3020

Accession MIMAT0014756
Sequence

1 - 

guaagaauaaugauccauuaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).