Stem-loop sequence api-mir-3023

AccessionMI0013966 (change log)
DescriptionAcyrthosiphon pisum miR-3023 stem-loop
Stem-loop
   --          uuu      c     aaaa 
5'   ggcauuucug   ucaagc uuauu    u
     ||||||||||   |||||| |||||     
3'   cuguaaagac   aguucg aauaa    u
   ag          uuu      -     aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350151.1: 170256-170316 [-]
intergenic
Database links

Mature sequence api-miR-3023

Accession MIMAT0014759
Sequence

39 - 

aagcuugauuucagaaaugucga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).