Stem-loop sequence api-mir-3024

AccessionMI0013967 (change log)
DescriptionAcyrthosiphon pisum miR-3024 stem-loop
Stem-loop
   uc    gg      uag   c   ---    a 
5'   uuug  auuuaa   agc ggu   ugaa u
     ||||  ||||||   ||| |||   |||| u
3'   aaac  uaaauu   ucg cca   gcuu g
   ua    uu      cua   a   uau    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350117.1: 223576-223639 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-3024
api-mir-3032GL350117.1: 224322-224383 [-]
api-mir-3024GL350117.1: 223576-223639 [-]
api-mir-3016GL350117.1: 223456-223518 [-]
api-mir-3053GL350117.1: 223099-223161 [-]
Database links

Mature sequence api-miR-3024

Accession MIMAT0014760
Sequence

1 - 

ucuuugggauuuaauagagccggu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).