Stem-loop sequence api-mir-3027

AccessionMI0013970 (change log)
DescriptionAcyrthosiphon pisum miR-3027 stem-loop
Stem-loop
   --g       u         ua     aau 
5'    gggauaa uguaggacu  cugug   u
      ||||||| |||||||||  |||||   u
3'    ccuuauu acguucuga  gacau   g
   uca       u         cc     aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350604.1: 163757-163817 [-]
intergenic
Database links

Mature sequence api-miR-3027

Accession MIMAT0014763
Sequence

40 - 

ccagucuugcauuuauuccacu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).