Stem-loop sequence api-mir-3029

AccessionMI0013972 (change log)
DescriptionAcyrthosiphon pisum miR-3029 stem-loop
Stem-loop
   --uu        ca  c       c aaua 
5'     gguaacau  ac ucuuuag g    u
       ||||||||  || ||||||| |    u
3'     ccauugua  ug agaaauc c    u
   gcgu        aa  c       a gcag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349928.1: 621458-621518 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-3029
api-mir-3030GL349928.1: 618630-618692 [+]
api-mir-3041GL349928.1: 621192-621257 [+]
api-mir-3029GL349928.1: 621458-621518 [+]
Database links

Mature sequence api-miR-3029

Accession MIMAT0014765
Sequence

40 - 

aaagacguaaauguuaccugcg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).