Stem-loop sequence api-mir-3031

AccessionMI0013974 (change log)
DescriptionAcyrthosiphon pisum miR-3031 stem-loop
Stem-loop
   -  -                   --       
5'  gg gaaauuuguuaagaagcaa  aguguu 
    || |||||||||||||||||||  ||||| a
3'  uc cuuugaacaauuuuucguu  uuauaa 
   a  a                   cc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350343.1: 72875-72933 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-3031
api-mir-3037GL350343.1: 71782-71844 [+]
api-mir-3047-1GL350343.1: 72020-72080 [+]
api-mir-3031GL350343.1: 72875-72933 [+]
api-mir-3047-2GL350343.1: 73002-73062 [+]
Database links

Mature sequence api-miR-3031

Accession MIMAT0014767
Sequence

37 - 

uugcuuuuuaacaaguuucacua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).