Stem-loop sequence api-mir-3032

AccessionMI0013975 (change log)
DescriptionAcyrthosiphon pisum miR-3032 stem-loop
Stem-loop
   --u u        -    u   a     gaau 
5'    g uaguauaa cucu agu acagu    u
      | |||||||| |||| ||| |||||     
3'    c aucauauu gaga uca uguua    u
   uag c        u    -   g     aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350117.1: 224322-224383 [-]
intergenic
Clustered miRNAs
< 10kb from api-mir-3032
api-mir-3032GL350117.1: 224322-224383 [-]
api-mir-3024GL350117.1: 223576-223639 [-]
api-mir-3016GL350117.1: 223456-223518 [-]
api-mir-3053GL350117.1: 223099-223161 [-]
Database links

Mature sequence api-miR-3032

Accession MIMAT0014768
Sequence

1 - 

uguuaguauaacucuuaguaaca

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).