Dead miRNA entry

miRNA accession:
MI0013978
miRNA ID:
api-mir-3034-2
Forward to:
MI0013977
Comment:
Two previously annotated mir-3034 entries map to the same locus in the AphidBase2 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence api-mir-3034-2

AccessionMI0013978 (change log)
DescriptionAcyrthosiphon pisum miR-3034-2 stem-loop
Stem-loop
   --    a      aaugacaa       a      g 
5'   ugca cuguac        uaguagg uuauag g
     |||| ||||||        ||||||| ||||||  
3'   acgu gacaug        aucaucc aauauc g
   cu    c      -gaauaua       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence api-miR-3034

Accession MIMAT0014770
Sequence

1 - 

 ugcaacuguacaaugacaauaguagg

 - 27

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).