Stem-loop sequence api-mir-252b

AccessionMI0013981 (change log)
DescriptionAcyrthosiphon pisum miR-252b stem-loop
Literature search

1 open access papers mention api-mir-252b
(1 sentences)

Stem-loop
   --c          cg -  ac     auug  u 
5'    uaaguaguag  c ca  gguga    au u
      ||||||||||  | ||  |||||    || u
3'    auucgucauc  g gu  ccacu    ua a
   acc          au c  --     -gua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349872.1: 513369-513431 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-252b
api-mir-252bGL349872.1: 513369-513431 [+]
api-mir-252aGL349872.1: 519999-520063 [+]
Database links

Mature sequence api-miR-252b

Accession MIMAT0014772
Sequence

1 - 

cuaaguaguagcgccaacgguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).