Stem-loop sequence api-mir-3037

AccessionMI0013987 (change log)
DescriptionAcyrthosiphon pisum miR-3037 stem-loop
Stem-loop
   --              a    a      c  ug 
5'   aaauucugaauguu uugu gacauu ua  a
     |||||||||||||| |||| |||||| ||   
3'   uuuaagacuuacaa aaca uuguaa au  u
   gu              -    -      -  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350343.1: 71782-71844 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-3037
api-mir-3037GL350343.1: 71782-71844 [+]
api-mir-3047-1GL350343.1: 72020-72080 [+]
api-mir-3031GL350343.1: 72875-72933 [+]
api-mir-3047-2GL350343.1: 73002-73062 [+]
Database links

Mature sequence api-miR-3037

Accession MIMAT0014774
Sequence

42 - 

uuacaaaacauucagaauuuug

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).