Stem-loop sequence api-mir-3038

AccessionMI0013988 (change log)
DescriptionAcyrthosiphon pisum miR-3038 stem-loop
Stem-loop
   --         a ua      ua - -  aca 
5'   ugggguuuc a  ggcauu  c c cg   u
     ||||||||| |  ||||||  | | ||    
3'   acccuaaag u  ccguaa  g g gc   u
   gu         a uc      cg a a  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350549.1: 145537-145598 [+]
intergenic
Database links

Mature sequence api-miR-3038

Accession MIMAT0014775
Sequence

1 - 

ugggguuucaauaggcauuuacc

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).