Stem-loop sequence api-mir-3041

AccessionMI0013992 (change log)
DescriptionAcyrthosiphon pisum miR-3041 stem-loop
Stem-loop
   --      u                c  a a gu 
5'   ucuugu caucaaaguuuuaggu gu c c  c
     |||||| |||||||||||||||| || | |  u
3'   agggca guaguuucgaaauuca ca g g  a
   au      -                -  a - au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349928.1: 621192-621257 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-3041
api-mir-3030GL349928.1: 618630-618692 [+]
api-mir-3041GL349928.1: 621192-621257 [+]
api-mir-3029GL349928.1: 621458-621518 [+]
Database links

Mature sequence api-miR-3041

Accession MIMAT0014779
Sequence

45 - 

uuaaagcuuugaugacgggaua

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).