Stem-loop sequence api-mir-3042

AccessionMI0013993 (change log)
DescriptionAcyrthosiphon pisum miR-3042 stem-loop
Stem-loop
   --         uuau     a   gauuuuga 
5'   gagggcaga    uucug uac        c
     |||||||||    ||||| |||         
3'   uuccugucu    gagac aug        u
   uc         uaau     a   gacaguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349736.1: 585356-585419 [-]
intergenic
Database links

Mature sequence api-miR-3042

Accession MIMAT0014780
Sequence

1 - 

gagggcagauuauuucugauac

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).