Stem-loop sequence api-mir-3017b-1

AccessionMI0013998 (change log)
DescriptionAcyrthosiphon pisum miR-3017b-1 stem-loop
Gene family MIPF0001107; mir-3017
Stem-loop
   --              u   u   cu   aacg 
5'   ccguguucugugac gac cgg  ggc    g
     |||||||||||||| ||| |||  |||     
3'   ggcacaaggcacug cug gcc  ccg    a
   ag              u   -   uc   aguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349670.1: 628441-628505 [+]
intergenic
Database links

Mature sequence api-miR-3017b

Accession MIMAT0014783
Sequence

44 - 

cggucugucacggaacacggga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).