Stem-loop sequence api-mir-3051-1

AccessionMI0014010 (change log)
DescriptionAcyrthosiphon pisum miR-3051-1 stem-loop
Gene family MIPF0001114; mir-3051
Stem-loop
   --a       uu   a        -  --au        a 
5'    aggaacg  aaa accauugu gu    auguuuaa u
      |||||||  ||| |||||||| ||    ||||||||  
3'    ucuuugc  uuu ugguaaca ca    uguaaauu c
   aua       uu   g        a  aaau        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349714.1: 1085537-1085613 [-]
intergenic
Database links

Mature sequence api-miR-3051

Accession MIMAT0014792
Sequence

1 - 

aaggaacguuaaaaaccauugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).