Stem-loop sequence api-mir-3051-2

AccessionMI0014011 (change log)
DescriptionAcyrthosiphon pisum miR-3051-2 stem-loop
Gene family MIPF0001114; mir-3051
Stem-loop
   --a       uu   a        ----   uau   uga 
5'    aggaacg  aaa accauugu    gua   guu   a
      |||||||  ||| ||||||||    |||   |||   u
3'    ucuuugc  uuu ugguaaca    cau   caa   c
   aua       uu   g        gcaa   uuu   uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350503.1: 32349-32425 [+]
intergenic
Database links

Mature sequence api-miR-3051

Accession MIMAT0014792
Sequence

1 - 

aaggaacguuaaaaaccauugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).