Stem-loop sequence api-mir-3052

AccessionMI0014012 (change log)
DescriptionAcyrthosiphon pisum miR-3052 stem-loop
Stem-loop
   -ca       --auu    -u   -------       u 
5'    caucaug     cucg  gaa       gagggag u
      |||||||     ||||  |||       |||||||  
3'    guaguac     gagu  cuu       cucucuc u
   ucg       gauuc    uu   acguacc       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349667.1: 508338-508406 [+]
intergenic
Database links

Mature sequence api-miR-3052

Accession MIMAT0014793
Sequence

42 - 

ugcauucuuugagcuuagcaugauggcu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).