Stem-loop sequence api-mir-3015c

AccessionMI0014013 (change log)
Previous IDsapi-mir-3015c-1
DescriptionAcyrthosiphon pisum miR-3015c stem-loop
Gene family MIPF0001111; mir-3015
Stem-loop
   --           ug c      -  guc 
5'   guucuuacaau  c gguuaa gu   g
     |||||||||||  | |||||| ||    
3'   caagaauguug  g ccaauu ca   a
   ag           ua a      u  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350550.1: 174339-174395 [-]
intergenic
Database links

Mature sequence api-miR-3015c

Accession MIMAT0014794
Sequence

37 - 

aaccagauguuguaagaacga

 - 57

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).