Dead miRNA entry

miRNA accession:
MI0014014
miRNA ID:
api-mir-3015c-2
Forward to:
MI0014013
Comment:
Two previously annotated mir-3015c entries map to the same locus in the AphidBase2 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence api-mir-3015c-2

AccessionMI0014014 (change log)
DescriptionAcyrthosiphon pisum miR-3015c-2 stem-loop
Stem-loop
   --           ug c      -  guc 
5'   guucuuacaau  c gguuaa gu   g
     |||||||||||  | |||||| ||    
3'   caagaauguug  g ccaauu ca   a
   ag           ua a      u  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence api-miR-3015c

Accession MIMAT0014794
Sequence

37 - 

uaaccagauguuguaagaacg

 - 57

Get sequence
Evidence experimental;

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).