Stem-loop sequence mmu-mir-3061

AccessionMI0014023 (change log)
Symbol MGI:Mir3061
DescriptionMus musculus miR-3061 stem-loop
Literature search

3 open access papers mention mmu-mir-3061
(5 sentences)

Stem-loop
                        cg g           ggu g  cc 
5' guguacuguggggcagugggc  u aaagguagccu   g uc  c
   |||||||||||||||||||||  | |||||||||||   | ||   
3' uacguggcaccccgucaccug  a uuuccaucgga   c ag  u
                        au g           -au g  uu 
Get sequence
Deep sequencing
1176 reads, 0 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 52126746-52126836 [+]
sense
OTTMUST00000012505 ; Ppp2ca-001; exon 7
ENSMUST00000020608 ; Ppp2ca-001; exon 7
antisense
ENSMUST00000181262 ; Gm26551-201; intron 1
ENSMUST00000180832 ; mmu-mir-3061.1-201; exon 1
Database links

Mature sequence mmu-miR-3061-5p

Accession MIMAT0014828
Sequence

14 - 

cagugggccgugaaagguagcc

 - 35

Get sequence
Deep sequencing666 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3061-3p

Accession MIMAT0014829
Sequence

59 - 

cuaccuuugauaguccacugcc

 - 80

Get sequence
Deep sequencing505 reads, 66 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).