Stem-loop sequence bmo-mir-2808e

AccessionMI0014289 (change log)
DescriptionBombyx mori miR-2808e stem-loop
Gene family MIPF0000836; mir-2808
Literature search

1 open access papers mention bmo-mir-2808e
(1 sentences)

Stem-loop
   -      cg    u  aa   --a   gc     a a    a -  cc      gu 
5'  agcuca  gggc ca  ccg   agu  uucgc g aucu c ca  gggucg  a
    ||||||  |||| ||  |||   |||  ||||| | |||| | ||  ||||||   
3'  uugggu  ucug gu  ggu   uca  gagug c uaga g gu  cccagc  g
   a      -a    u  cg   gac   au     g c    a a  ca      gc 
Get sequence
Deep sequencing
390 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581762.1: 604257-604365 [+]
intergenic
Database links

Mature sequence bmo-miR-2808e

Accession MIMAT0015417
Sequence

65 - 

ugagaagauccggugaguaacu

 - 86

Get sequence
Deep sequencing226 reads, 3 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).