Stem-loop sequence bmo-mir-3314

AccessionMI0014372 (change log)
DescriptionBombyx mori miR-3314 stem-loop
Literature search

1 open access papers mention bmo-mir-3314
(1 sentences)

Stem-loop
   g  cau      au   aaa    u  ca   u  c        a  -  ac   c  aucc 
5'  gg   ggcggc  cgc   uguu gc  ugg gc ccggaacc gc cg  cuc gc    a
    ||   ||||||  |||   |||| ||  ||| || |||||||| || ||  ||| ||     
3'  cc   ccgccg  gcg   acga cg  acc cg gguuuugg cg gc  gag cg    c
   a  --u      --   aca    -  -c   -  c        g  c  -c   -  ccug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004601752.1: 140-255 [+]
intergenic
Database links

Mature sequence bmo-miR-3314

Accession MIMAT0015502
Sequence

93 - 

acgcagcaacagcggccgccucc

 - 115

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).