Stem-loop sequence bmo-mir-3318

AccessionMI0014376 (change log)
DescriptionBombyx mori miR-3318 stem-loop
Literature search

1 open access papers mention bmo-mir-3318
(1 sentences)

Stem-loop
   au   -  auc      ---u   -----u        g  -----------     -uaaaaaa      a  - aca 
5'   gac cu   ggauuu    aca      uuuugcau uu           gcgcu        uuagac ca g   c
     ||| ||   ||||||    |||      |||||||| ||           |||||        |||||| || |    
3'   cug ga   ucuaga    ugu      aaagcgua gg           cgcga        aguuug gu c   u
   -u   u  ---      uguu   uaccau        g  aauaauaaauu     cuauccua      c  g ccg 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581690.1: 338052-338185 [+]
intergenic
NW_004581690.1: 339793-339926 [+]
intergenic
NW_004595470.1: 174-307 [+]
intergenic
NW_004606548.1: 335-468 [+]
intergenic
NW_004607167.1: 167-300 [-]
intergenic
Database links

Mature sequence bmo-miR-3318

Accession MIMAT0015506
Sequence

11 - 

ggauuuuacauuuuugcauguugc

 - 34

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).