Stem-loop sequence aly-MIR156b

AccessionMI0014503 (change log)
DescriptionArabidopsis lyrata miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
       -    ----a           -     -       au   g  ucu      u 
5' aaca gaga     aacugacagaa gagag ugagcac  gca gc   guuaug g
   |||| ||||     ||||||||||| ||||| |||||||  ||| ||   ||||||  
3' uugu cucu     uugacugucuu cucuc acucgug  ugu cg   caauau u
       u    auucg           u     c       cg   g  uuu      c 
Get sequence
Deep sequencing
277 reads, 8.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 4534117-4534225 [-]
intergenic
Database links

Mature sequence aly-miR156b-5p

Accession MIMAT0017399
Previous IDsaly-miR156b
Sequence

13 - 

ugacagaagagagugagcac

 - 32

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR156b-3p

Accession MIMAT0017400
Previous IDsaly-miR156b*
Sequence

73 - 

gcucaccucucuuucugucagu

 - 94

Get sequence
Deep sequencing36 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2