Stem-loop sequence aly-MIR156g

AccessionMI0014508 (change log)
DescriptionArabidopsis lyrata miR156g stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
        u   u  u   uaacaaua    a  c    -               a  u    ccuuu   u     g 
5' ggagg aag ga gaa        agga gg gaca gaagagagugagcac ca ggcu     uuc agcau c
   ||||| ||| || |||        |||| || |||| ||||||||||||||| || ||||     ||| |||||  
3' ucucu uuc cu cuu        uccu cc cugu cuucucucauucgug gu ucga     aag ucgua u
        -   u  -   -----ucg    -  u    u               c  c    -----   c     c 
Get sequence
Deep sequencing
156 reads, 5.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 21084413-21084550 [+]
intergenic
Database links

Mature sequence aly-miR156g-5p

Accession MIMAT0017409
Previous IDsaly-miR156g
Sequence

32 - 

cgacagaagagagugagcac

 - 51

Get sequence
Deep sequencing156 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence aly-miR156g-3p

Accession MIMAT0017410
Previous IDsaly-miR156g*
Sequence

97 - 

gcuuacucucuucuugucucc

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).