Stem-loop sequence aly-MIR157a

AccessionMI0014510 (change log)
DescriptionArabidopsis lyrata miR157a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
         -u      -  u         -a             u  -      a   uuc    c 
5' gaggca  ugagag ug ugacagaag  uagagagcacaga ga uaagau caa   ggag a
   ||||||  |||||| || |||||||||  ||||||||||||| || |||||| |||   ||||  
3' uuucgu  auuuuc ac acugucuuc  aucucucguguuu cu auucua guu   ucuu g
         uu      c  u         cg             c  c      c   ---    u 
Get sequence
Deep sequencing
241 reads, 7.8e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 11818143-11818265 [-]
intergenic
Database links

Mature sequence aly-miR157a-5p

Accession MIMAT0017413
Previous IDsaly-miR157a
Sequence

16 - 

uugacagaagauagagagcac

 - 36

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR157a-3p

Accession MIMAT0017414
Previous IDsaly-miR157a*
Sequence

87 - 

gcucucuagccuucugucauca

 - 108

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2