Stem-loop sequence aly-MIR157c

AccessionMI0014512 (change log)
DescriptionArabidopsis lyrata miR157c stem-loop
Gene family MIPF0000008; MIR156
   cauacuuuaugauguugcauauaucacacauacguuugagagugaugcugguuguugacagaagauagagagcacuaaggaugacaugcaagcacauacauauaucaucacaccccauguggaugauaaaauauguauaacaaauucaagaaa         ag      -----------    u   g      --a       aa     c 
5'                                                                                                                                                          gagagagag  agagau           caga gua agggag   gggagag  agaga u
                                                                                                                                                            |||||||||  ||||||           |||| ||| ||||||   |||||||  ||||| g
3'                                                                                                                                                          cucucucuu  ucuuua           gucu cau ucucuc   uuuucuc  ucucu c
   ----------------------------------------------------------------------------------------------------------------------------guaucuacacugacacgcauauacaucca         cu      uuuccaccacu    u   a      gug       -a     a 
Get sequence
Deep sequencing
252 reads, 8.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 7799851-7800143 [-]
Database links

Mature sequence aly-miR157c-5p

Accession MIMAT0017417
Previous IDsaly-miR157c

55 - 


 - 75

Get sequence
Deep sequencing240 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR157c-3p

Accession MIMAT0017418
Previous IDsaly-miR157c*

221 - 


 - 241

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]


PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).