Stem-loop sequence aly-MIR158a

AccessionMI0014514 (change log)
DescriptionArabidopsis lyrata miR158a stem-loop
Gene family MIPF0000294; MIR158
Stem-loop
           u u   cuu           a   u     a  ug   a 
5' acgucauc c gug   cuuugucuaca uuu ggaaa ag  gug c
   |||||||| | |||   ||||||||||| ||| ||||| ||  |||  
3' ugcaguag g cau   gaaacagaugu aaa ccuuu uc  uac g
           u c   aac           -   c     c  gu   c 
Get sequence
Deep sequencing
397 reads, 1.25e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 4310355-4310449 [-]
intergenic
Database links

Mature sequence aly-miR158a-5p

Accession MIMAT0017421
Previous IDsaly-miR158a*
Sequence

18 - 

cuuugucuacaauuuuggaaa

 - 38

Get sequence
Deep sequencing53 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR158a-3p

Accession MIMAT0017422
Previous IDsaly-miR158a
Sequence

61 - 

ucccaaauguagacaaagca

 - 80

Get sequence
Deep sequencing344 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2