Stem-loop sequence aly-MIR159a

AccessionMI0014515 (change log)
DescriptionArabidopsis lyrata miR159a stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
        aaaa     u   a            ga        c      -u    ------       aga      g  a  c    g uc     -    cu       auaaa 
5' gagaa    aaaga gga guagagcuccuu  aguucaaa gagagu  gagc      aggguaa   aaagcu cu ag uaug a  ccaua agcc  aauccuu     g
   |||||    ||||| ||| ||||||||||||  |||||||| ||||||  ||||      |||||||   |||||| || || |||| |  ||||| ||||  |||||||      
3' cucuu    uuucu ucu caucucgaggga  uuagguuu uucuca  uucg      ucccguu   uuucga ga uc auac u  gguau uugg  uuaggaa     a
        ccac     -   a            ag        c      uu    guaauu       caa      g  c  u    g uc     a    -u       aaaaa 
Get sequence
Deep sequencing
8353 reads, 2.87e+05 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 15958623-15958844 [-]
intergenic
Database links

Mature sequence aly-miR159a-5p

Accession MIMAT0017423
Previous IDsaly-miR159a*
Sequence

23 - 

gagcuccuugaaguucaaacg

 - 43

Get sequence
Deep sequencing172 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR159a-3p

Accession MIMAT0017424
Previous IDsaly-miR159a
Sequence

183 - 

uuuggauugaagggagcucua

 - 203

Get sequence
Deep sequencing8148 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2