Stem-loop sequence aly-MIR159c

AccessionMI0014517 (change log)
DescriptionArabidopsis lyrata miR159c stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
                   -c      a         ca   uuug    acuaaaaagcaaaaucuaagaguucauggauuccucauagagagugcguagguuaacaucuugaa 
5' agaaggagcucccuuc  uccaaa cgaggagga  aga    agga                                                                 g
   ||||||||||||||||  |||||| |||||||||  |||    ||||                                                                 a
3' uuuuccucgagggaag  agguuu gcuucucuu  ucu    uccu                                                                 a
                   uu      -         -c   ----    acauaucucucucucucucucucucucuauuagauucuccaguacgucaggggaauuucacacga 
Get sequence
Deep sequencing
7093 reads, 2.46e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 22446169-22446388 [+]
intergenic
Database links

Mature sequence aly-miR159c-5p

Accession MIMAT0017427
Previous IDsaly-miR159c*
Sequence

6 - 

gagcucccuuccuccaaaacg

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR159c-3p

Accession MIMAT0017428
Previous IDsaly-miR159c
Sequence

197 - 

uuuggauugaagggagcuccu

 - 217

Get sequence
Deep sequencing7092 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).