Stem-loop sequence aly-MIR160a

AccessionMI0014521 (change log)
DescriptionArabidopsis lyrata miR160a stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
       ua      ua   ag            uauauau      c       cu         a   u   c      a 
5' cgcc  uacaug  uau  auguauauguau       guaugc uggcucc  guaugccau ugc gag ucaucg g
   ||||  ||||||  |||  ||||||||||||       |||||| |||||||  ||||||||| ||| ||| |||||| u
3' gugg  guguau  aua  uauauauacaua       uauacg accgagg  uaugcggua gug cuc aguagc a
       ua      ua   ca            ---cucc      u       ag         g   c   c      u 
Get sequence
Deep sequencing
168 reads, 5.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 18997241-18997398 [+]
intergenic
Database links

Mature sequence aly-miR160a-5p

Accession MIMAT0017435
Previous IDsaly-miR160a
Sequence

42 - 

ugccuggcucccuguaugcca

 - 62

Get sequence
Deep sequencing155 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR160a-3p

Accession MIMAT0017436
Previous IDsaly-miR160a*
Sequence

102 - 

gcguaugaggagccaugcaua

 - 122

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2