Stem-loop sequence aly-MIR166a

AccessionMI0014532 (change log)
DescriptionArabidopsis lyrata miR166a stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
        uuucu uu   a        uu      cu   g   u   --    gcucuauucauguuggaucuuuuucgaucuaau 
5' ggggu     c  uug ggggaaug  gucugg  cga gac cug  gcuc                                 a
   |||||     |  ||| ||||||||  ||||||  ||| ||| |||  ||||                                  
3' ccucg     g  aac ccccuuac  cggacc  gcu cug gau  uggg                                 a
        ---uu uu   c        uu      ag   g   c   uu    aucagucuagacuuuagaccuccaaguuaagcu 
Get sequence
Deep sequencing
159 reads, 4.6e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 22684209-22684375 [+]
intergenic
Database links

Mature sequence aly-miR166a-5p

Accession MIMAT0017459
Previous IDsaly-miR166a*
Sequence

20 - 

ggaauguugucuggcucgagg

 - 40

Get sequence
Deep sequencing27 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR166a-3p

Accession MIMAT0017460
Previous IDsaly-miR166a
Sequence

133 - 

ucggaccaggcuucauucccc

 - 153

Get sequence
Deep sequencing132 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2