Stem-loop sequence aly-MIR168a

AccessionMI0014543 (change log)
DescriptionArabidopsis lyrata miR168a stem-loop
Gene family MIPF0000081; MIR168
Stem-loop
      ---   --    g     -c  g      c          u     a       ggcugacacagccucgugacuuu 
5' gag   ucu  cacc ucggg  uc gauucg uuggugcagg cggga ccaauuc                       a
   |||   |||  |||| |||||  || |||||| |||||||||| ||||| |||||||                        
3' cuc   aga  gugg agccc  ag cuaagu aacuacguuc gcccu gguuagg                       a
      aaa   au    -     cu  g      c          c     a       gacgaguguuugguuauuuccaa 
Get sequence
Deep sequencing
416 reads, 1.28e+04 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 10245606-10245760 [-]
intergenic
Database links

Mature sequence aly-miR168a-5p

Accession MIMAT0017481
Previous IDsaly-miR168a
Sequence

24 - 

ucgcuuggugcaggucgggaa

 - 44

Get sequence
Deep sequencing348 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR168a-3p

Accession MIMAT0017482
Previous IDsaly-miR168a*
Sequence

109 - 

cccgccuugcaucaacugaau

 - 129

Get sequence
Deep sequencing67 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2