Stem-loop sequence aly-MIR169a

AccessionMI0014545 (change log)
DescriptionArabidopsis lyrata miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
        g      a   ----          c         ug           uaa     cuuucuuuauacucuauuaagacauuuuaaguuucaaauuucuuugguucuucaaggauuaaggaagaaagua 
5' aacgc uaugug cga    aaguagugug agccaagga  acuugccgauu   augau                                                                         g
   ||||| |||||| |||    |||||||||| |||||||||  |||||||||||   |||||                                                                         g
3' uugug auacgc gcu    uucauugcac ucgguuccu  ugaacggcuag   uacua                                                                         c
        g      -   gugu          a         gu           ---     acaaugaaaaagaaaaaaccagaauagaacauguauauaaauuaugucguauuauauauauagauguauauau 
Get sequence
Deep sequencing
75 reads, 2.1e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 5439432-5439694 [-]
intergenic
Database links

Mature sequence aly-miR169a-5p

Accession MIMAT0017485
Previous IDsaly-miR169a
Sequence

27 - 

cagccaaggaugacuugccga

 - 47

Get sequence
Deep sequencing60 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR169a-3p

Accession MIMAT0017486
Previous IDsaly-miR169a*
Sequence

216 - 

ggcaaguuguccuuggcuaca

 - 236

Get sequence
Deep sequencing15 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2