Stem-loop sequence aly-MIR169b

AccessionMI0014546 (change log)
DescriptionArabidopsis lyrata miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
   -gug     c    u  aa        agu    u      u    c    -     ug           cgu    a   au     u 
5'     cccaa ggag ag  uugcauga   ggag agagua aaug agcc aagga  acuugccggaa   uguu auc  acgua a
       ||||| |||| ||  ||||||||   |||| |||||| |||| |||| |||||  |||||||||||   |||| |||  ||||| a
3'     ggguu ucuc uc  aacguacu   cuuc ucucgu uuac ucgg uuccu  ugaacggucuu   acaa uag  uguau a
   uaua     -    -  -a        cuu    -      u    a    c     gu           uau    g   --     u 
Get sequence
Deep sequencing
72 reads, 2e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 10974240-10974412 [+]
intergenic
Database links

Mature sequence aly-miR169b-5p

Accession MIMAT0017487
Previous IDsaly-miR169b
Sequence

46 - 

cagccaaggaugacuugccgg

 - 66

Get sequence
Deep sequencing69 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169b-3p

Accession MIMAT0017488
Previous IDsaly-miR169b*
Sequence

112 - 

ggcaaguuguccuucggcuaca

 - 133

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2