Stem-loop sequence aly-MIR169l

AccessionMI0014556 (change log)
DescriptionArabidopsis lyrata miR169l stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
   ----------   aaga    uau  u      gag    c        -c         c     -ua           u    u      -u   uuuc    c  u            auuucauggg                auc 
5'           guu    aaug   ga gaagau   aggu uaacaugg  gaaaagagu auguu   auagccaagga gacu gccuga  cuu    accu ca gauucaauuuga          uuuuggauuauuaugc   u
             |||    ||||   || ||||||   |||| ||||||||  ||||||||| |||||   ||||||||||| |||| ||||||  |||    |||| || ||||||||||||          ||||||||||||||||   a
3'           uag    uuau   uu cuuuua   ucca auuguacc  cuuuucuca uacag   uaucgguuccu cuga cggacu  gga    uggg gu cuaaguugaacu          aaagcuuaauaaugug   a
   uaggaguuua   -gag    uuu  u      --a    u        ua         -     uuc           -    -      uu   ---u    c  u            ---------a                gaa 
Get sequence
Deep sequencing
39 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3149048-3149319 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169l
aly-MIR169nGL348717.1: 3151664-3151915 [-]
aly-MIR169mGL348717.1: 3151345-3151574 [-]
aly-MIR169lGL348717.1: 3149048-3149319 [-]
aly-MIR169kGL348717.1: 3143745-3143947 [-]
Database links

Mature sequence aly-miR169l-5p

Accession MIMAT0017507
Previous IDsaly-miR169l
Sequence

59 - 

uagccaaggaugacuugccug

 - 79

Get sequence
Deep sequencing32 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169l-3p

Accession MIMAT0017508
Previous IDsaly-miR169l*
Sequence

190 - 

ggcagucuccuuggcuauc

 - 208

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2