Stem-loop sequence aly-MIR169n

AccessionMI0014558 (change log)
DescriptionArabidopsis lyrata miR169n stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
       ugu   ac        g    c        -c        u      u  -          u    u      -u   uuuc    c  u       uuugaauuc    gg                auu 
5' gaag   aua  gaggaaaa aggu uaacaugg  gaaaagag cauguu ag uagccaaaga gacu gccuga  cuu    accu ca gauucaa         caug  uuuuggauuauuaugc   u
   ||||   |||  |||||||| |||| ||||||||  |||||||| |||||| || |||||||||| |||| ||||||  |||    |||| || |||||||         ||||  ||||||||||||||||   u
3' cuuc   ugu  uucuuuuu ucca auuguacu  cuuuuuuc guacag uc aucgguuucu cuga cggacu  gga    uggg gu cuaaguu         guac  aaagcuugauaauacg   a
       ---   cu        a    u        ua        -      u  u          -    -      uu   ---u    c  u       ---------    ua                aaa 
Get sequence
Deep sequencing
27 reads, 600 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 3151664-3151915 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR169n
aly-MIR169nGL348717.1: 3151664-3151915 [-]
aly-MIR169mGL348717.1: 3151345-3151574 [-]
aly-MIR169lGL348717.1: 3149048-3149319 [-]
aly-MIR169kGL348717.1: 3143745-3143947 [-]
Database links

Mature sequence aly-miR169n-5p

Accession MIMAT0017511
Previous IDsaly-miR169n
Sequence

54 - 

uagccaaagaugacuugccug

 - 74

Get sequence
Deep sequencing23 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169n-3p

Accession MIMAT0017512
Previous IDsaly-miR169n*
Sequence

185 - 

ggcagucucuuuggcuauc

 - 203

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2