Stem-loop sequence aly-MIR172b

AccessionMI0014564 (change log)
DescriptionArabidopsis lyrata miR172b stem-loop
Gene family MIPF0000035; MIR172
Stem-loop
        ---------caucu       u    a         c           a    aaa  uga    u u      
5' uagcu              gucguug uugu ggugcagca caucaagauuc caug   au   uaaa c ccuaa 
   |||||              ||||||| |||| ||||||||| ||||||||||| ||||   ||   |||| | |||| a
3' gucga              cggcagc aaca cuacgucgu guaguucuaag guau   ua   guuu g ggauu 
        aauccauaaaacau       u    a         a           a    aug  -ua    u -      
Get sequence
Deep sequencing
3503 reads, 1.19e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 1397230-1397375 [-]
intergenic
Database links

Mature sequence aly-miR172b-5p

Accession MIMAT0017523
Previous IDsaly-miR172b*
Sequence

27 - 

gcagcaccaucaagauucaca

 - 47

Get sequence
Deep sequencing20 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR172b-3p

Accession MIMAT0017524
Previous IDsaly-miR172b
Sequence

93 - 

agaaucuugaugaugcugcau

 - 113

Get sequence
Deep sequencing3483 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2