Stem-loop sequence aly-MIR172e

AccessionMI0014567 (change log)
DescriptionArabidopsis lyrata miR172e stem-loop
Gene family MIPF0000035; MIR172
Stem-loop
       -   guc  a         c           a  aga  ugu  uu      g      ccuc 
5' gcca gua   gc gaugcagca cauuaagauuc ca   ga   gg  cccuuu uuuuug    u
   |||| |||   || ||||||||| ||||||||||| ||   ||   ||  |||||| ||||||     
3' cggu cau   cg cuacgucgu guaguucuaag gu   cu   cc  gggaaa agaagc    c
       a   aaa  a         a           g  gag  -uu  uu      -      cuag 
Get sequence
Deep sequencing
3105 reads, 1.07e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348720.1: 19150533-19150665 [+]
intergenic
Database links

Mature sequence aly-miR172e-5p

Accession MIMAT0017529
Previous IDsaly-miR172e*
Sequence

17 - 

gcagcaccauuaagauucac

 - 36

Get sequence
Deep sequencing18 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR172e-3p

Accession MIMAT0017530
Previous IDsaly-miR172e
Sequence

99 - 

gaaucuugaugaugcugcau

 - 118

Get sequence
Deep sequencing3087 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2