Stem-loop sequence aly-MIR394a

AccessionMI0014574 (change log)
DescriptionArabidopsis lyrata miR394a stem-loop
Gene family MIPF0000100; MIR394
Stem-loop
         --    cuuuaaacuu    -uccuuu   u        g  a     u    u     ca   -      u c gu         c  -g      -u ug   a 
5' uagauu  ggau          uugu       uca gaggguuu ac aagag uucu acaga  ucu uuggca u u  ccaccuccu cu  uacaug  g  uau u
   ||||||  ||||          ||||       ||| |||||||| || ||||| |||| |||||  ||| |||||| | |  ||||||||| ||  ||||||  |  |||  
3' gucuaa  ucug          aaca       agu cucccaaa ug uucuu ggga ugucu  aga aaccgu a a  gguggagga ga  gugugu  u  gua a
         gu    uaacuauuuc    uauaucu   u        a  c     u    u     ag   u      c u ug         a  ag      uu gu   u 
Get sequence
Deep sequencing
25 reads, 800 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 8699173-8699392 [+]
intergenic
Database links

Mature sequence aly-miR394a-5p

Accession MIMAT0017543
Previous IDsaly-miR394a
Sequence

68 - 

uuggcauucuguccaccucc

 - 87

Get sequence
Deep sequencing22 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR394a-3p

Accession MIMAT0017544
Previous IDsaly-miR394a*
Sequence

132 - 

agguggguauacugccaaua

 - 151

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2