Stem-loop sequence aly-MIR838

AccessionMI0014612 (change log)
DescriptionArabidopsis lyrata miR838 stem-loop
Gene family MIPF0001184; MIR838
Stem-loop
           cc           cc     c  u            u      c      u    a     ugugag      acuuc 
5' gaggacuu  auggccucaau  accuc gg guugugcaagaa gagaag aaagcc gucu uguau      auaucu     u
   ||||||||  |||||||||||  ||||| || |||||||||||| |||||| |||||| |||| |||||      ||||||     a
3' cuucugaa  uaucgggguua  uggag uc caacacguucuu uucuuc uuucgg caga acaug      uauagg     u
           ca           -a     -  -            c      u      c    -     ----ua      aucag 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 513681-513847 [-]
intergenic
Database links

Mature sequence aly-miR838-5p

Accession MIMAT0017621
Previous IDsaly-miR838*
Sequence

37 - 

ugcaagaaugagaagcaaagc

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR838-3p

Accession MIMAT0017622
Previous IDsaly-miR838
Sequence

116 - 

uuuucuucuucuucuugcaca

 - 136

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2