Stem-loop sequence aly-MIR395g

AccessionMI0014634 (change log)
DescriptionArabidopsis lyrata miR395g stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
           uuc  ua         ug         u     a   c   guc 
5' gucggaug   cc  gaguuccuc  agcacuuca uggag uac auu   u
   ||||||||   ||  |||||||||  ||||||||| ||||| ||| |||    
3' uagcuuac   gg  cucaagggg  uugugaagu aucuu aug uaa   a
           uca  uc         gu         c     -   a   agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 14005416-14005520 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR395g
aly-MIR395hGL348714.1: 14006209-14006343 [+]
aly-MIR395gGL348714.1: 14005416-14005520 [-]
aly-MIR395fGL348714.1: 14002867-14002993 [+]
aly-MIR395eGL348714.1: 14000953-14001057 [-]
aly-MIR395dGL348714.1: 13997965-13998104 [-]
Database links

Mature sequence aly-miR395g-5p

Accession MIMAT0017665
Previous IDsaly-miR395g*
Sequence

18 - 

guuccucugagcacuucauug

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR395g-3p

Accession MIMAT0017666
Previous IDsaly-miR395g
Sequence

70 - 

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2