Stem-loop sequence aly-MIR773b

AccessionMI0014642 (change log)
DescriptionArabidopsis lyrata miR773b stem-loop
Gene family MIPF0001106; MIR773
Stem-loop
     au   -cauc       -   c     a  gua         c  g       g              ca           u     uuc  a a          -  gag 
5' gc  caa     cucgaac gaa gaggg gu   gaugcuuaa gg ugaagga gcaauaucuuugaa  aacaguugauu uagaa   ca c acuaaaggug ug   a
   ||  |||     ||||||| ||| ||||| ||   ||||||||| || ||||||| ||||||||||||||  ||||||||||| |||||   || | |||||||||| ||   a
3' cg  guu     gagcuug cuu cucuc ca   cugcgaguu uc acuuccu uguuauaggaacuu  uuguuaacuaa gucuu   gu g ugauuuccau ac   c
     cu   auuaa       a   a     c  aaa         u  a       a              ac           c     cau  a c          g  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 17336043-17336268 [-]
intergenic
Database links

Mature sequence aly-miR773b-5p

Accession MIMAT0017683
Previous IDsaly-miR773b
Sequence

59 - 

uaucuuugaacaaacaguuga

 - 79

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aly-miR773b-3p

Accession MIMAT0017684
Previous IDsaly-miR773b*
Sequence

148 - 

aauuguucauucaaggauauu

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).